Molecular Basis of Inheritance · Question 18

Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'

1. 5'AUGUACCGUUUAUAGGUAAGU3'
2. 5'AUGUAAAGUUUAUAGGUAAGU3'
3. 5'AUGUACCGUUUAUAGGGAAGU3'
4. 5'ATGTACCGTTTATAGGTAAGT3'

Match List I with List II: Choose the correct answer from the options given below :

1. A-II, B-IV, C-I, D-III
2. A-III, B-II, C-IV, D-I
3. A-III, B-IV, C-I, D-II
4. A-IV, B-III, C-I, D-II

Given below are two statements regarding RNA polymerase in prokaryotes. In the light of the above statements, choose the correct answer from the options given below :

1. Statement I is true but Statement II is false
2. Statement I is false but Statement II is true
3. Both Statement I and Statement II are true
4. Both Statement I and Statement II are false

Given below are two statements: In the light of the above statements, choose the correct answer from the options given below:

1. Statement I is correct but Statement II is incorrect
2. Statement I is incorrect but Statement II is correct
3. Both Statement I and Statement II are correct
4. Both Statement I and Statement II are incorrect

Match List-I with List-II:

1. A-IV, B-III, C-II, D-I
2. A-III, B-I, C-IV, D-II
3. A-II, B-III, C-IV, D-I
4. A-III, B-IV, C-I, D-II

Given below are two statements : In the light of the above statements, choose the correct answer from the options given below :

1. Statement I is true but Statement II is false
2. Statement I is false but Statement II is true
3. Both Statement I and Statement II are true
4. Both Statement I and Statement II are false

Unequivocal proof that DNA is the genetic material was first proposed by

1. Alfred Hershey and Martha Chase
2. Avery, MacLeod and McCarty
3. Wilkins and Franklin
4. Frederick Griffith

What is the role of RNA polymerase III in the process of transcription in Eukaryotes?

1. Transcription of tRNA, 5S rRNA and snRNA
2. Transcription of precursor of mRNA
3. Transcription of only snRNAs
4. Transcription of rRNAs (28S, 18S and 5.8S)

Expressed Sequence Tags (ESTs) refer to

1. All genes that are expressed as proteins.
2. All genes whether expressed or unexpressed.
3. Certain important expressed genes.
4. All genes that are expressed as RNA.

How many different proteins does the ribosome consist of?

1. 60
2. 40
3. 20
4. 80