Molecular Basis of Inheritance · Question 13

Which factor is important for termination of transcription?

1. (rho)
2. (gamma)
3. (alpha)
4. (sigma)

The lactose present in the growth medium of bacteria is transported to the cell by the action of

1. Beta-galactosidase
2. Acetylase
3. Permease
4. Polymerase

A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;

1. Repressor, Operator gene, Structural gene
2. Structural gene, Transposons, Operator gene
3. Inducer, Repressor, Structural gene
4. Promoter, Structural gene, Terminator

Which of the following statement is correct regarding the process of replication in E. coli?

1. The DNA dependent DNA polymerase catalyses polymerization in one direction that is 3' 5'
2. The DNA dependent RNA polymerase catalyses polymerization in one direction, that is 5' 3'
3. The DNA dependent DNA polymerase catalyses polymerization in 5' 3' as well as 3' 5' direction
4. The DNA dependent DNA polymerase catalyses polymerization in 5' 3' direction

Match List I with List II Choose the correct answer from the options given below:

1. A-III, B-II, C-I, D-IV
2. A-III, B-IV, C-I, D-II
3. A-II, B-III, C-IV, D-I
4. A-IV, B-II, C-II, D-III

Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'

1. 5'AUGUACCGUUUAUAGGUAAGU3'
2. 5'AUGUAAAGUUUAUAGGUAAGU3'
3. 5'AUGUACCGUUUAUAGGGAAGU3'
4. 5'ATGTACCGTTTATAGGTAAGT3'

Match List I with List II: Choose the correct answer from the options given below :

1. A-II, B-IV, C-I, D-III
2. A-III, B-II, C-IV, D-I
3. A-III, B-IV, C-I, D-II
4. A-IV, B-III, C-I, D-II

Given below are two statements regarding RNA polymerase in prokaryotes. In the light of the above statements, choose the correct answer from the options given below :

1. Statement I is true but Statement II is false
2. Statement I is false but Statement II is true
3. Both Statement I and Statement II are true
4. Both Statement I and Statement II are false

Given below are two statements: In the light of the above statements, choose the correct answer from the options given below:

1. Statement I is correct but Statement II is incorrect
2. Statement I is incorrect but Statement II is correct
3. Both Statement I and Statement II are correct
4. Both Statement I and Statement II are incorrect

Match List-I with List-II:

1. A-IV, B-III, C-II, D-I
2. A-III, B-I, C-IV, D-II
3. A-II, B-III, C-IV, D-I
4. A-III, B-IV, C-I, D-II