Molecular Basis of Inheritance

In the lac operon, the z gene codes for :

1. the repressor of lac operon
2. transacetylase
3. permease
4. beta-galactosidase

Arrange the following steps of DNA fingerprinting in a correct sequence. Choose the correct answer from the options given below :

1. A, E, B, C, D
2. A, D, B, E, C
3. A, B, D, C, E
4. A, E, C, B, D

Which of the following statements are correct with reference to a transcription unit? Choose the correct answer from the options given below:

1. B, C, D and E only
2. A, B, C, D and E
3. A, B, C and D only
4. A, C, D and E only

Which of the following statements are correct with reference to packaging of DNA helix ? Choose the correct answer from the options given below :

1. B, D and E only
2. A, B and D only
3. C, D and E only
4. A, C and E only

Which of the following statements about lac-operon is correct?

1. Galactose can act as an inducer of lac operon
2. Gene i is constitutively expressed
3. Lactose activates repressor to bind to the operator
4. Genes i, z, y and a share single common promoter

Which of the following enzymes synthesizes precursor mRNA?

1. DNA polymerase
2. RNA polymerase I
3. RNA polymerase II
4. RNA polymerase III

Which chromosome in the human genome has the highest number of genes?

1. Chromosome 1
2. Chromosome 10
3. Chromosome X
4. Chromosome Y

Which of the following are the post-transcriptional events in a eukaryotic cell? Choose the correct answer from the options given below :

1. B, C, E only
2. C, D, E only
3. A, B, C only
4. B, C, D only

Given below are two statements: In the light of the above statements, choose the most appropriate answer from the options given below :

1. Statement I is correct but statement II is incorrect
2. Statement I is incorrect but statement II is correct
3. Both statement I and statement II are correct
4. Both statement I and statement II are incorrect

Given below are two statements : In the light of the above statements, choose the most appropriate answer from the options given below :

1. Statement I is correct but statement II is incorrect
2. Statement I is incorrect but statement II is correct
3. Both statement I and statement II are correct
4. Both statement I and statement II are incorrect

Who proposed that the genetic code for amino acids should be made up of three nucleotides?

1. Jacques Monod
2. Franklin Stahl
3. George Gamow
4. Francis Crick

Histones are enriched with -

1. Phenylalanine & Leucine
2. Phenylalanine & Arginine
3. Lysine & Arginine
4. Leucine & Lysine

Which factor is important for termination of transcription?

1. (rho)
2. (gamma)
3. (alpha)
4. (sigma)

The lactose present in the growth medium of bacteria is transported to the cell by the action of

1. Beta-galactosidase
2. Acetylase
3. Permease
4. Polymerase

A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and down stream end;

1. Repressor, Operator gene, Structural gene
2. Structural gene, Transposons, Operator gene
3. Inducer, Repressor, Structural gene
4. Promoter, Structural gene, Terminator

Which of the following statement is correct regarding the process of replication in E. coli?

1. The DNA dependent DNA polymerase catalyses polymerization in one direction that is 3' 5'
2. The DNA dependent RNA polymerase catalyses polymerization in one direction, that is 5' 3'
3. The DNA dependent DNA polymerase catalyses polymerization in 5' 3' as well as 3' 5' direction
4. The DNA dependent DNA polymerase catalyses polymerization in 5' 3' direction

Which one is the correct product of DNA dependent RNA polymerase to the given template? 3'TACATGGCAAATATCCATTCA5'

1. 5'AUGUACCGUUUAUAGGUAAGU3'
2. 5'AUGUAAAGUUUAUAGGUAAGU3'
3. 5'AUGUACCGUUUAUAGGGAAGU3'
4. 5'ATGTACCGTTTATAGGTAAGT3'

Given below are two statements regarding RNA polymerase in prokaryotes. In the light of the above statements, choose the correct answer from the options given below :

1. Statement I is true but Statement II is false
2. Statement I is false but Statement II is true
3. Both Statement I and Statement II are true
4. Both Statement I and Statement II are false

Given below are two statements: In the light of the above statements, choose the correct answer from the options given below:

1. Statement I is correct but Statement II is incorrect
2. Statement I is incorrect but Statement II is correct
3. Both Statement I and Statement II are correct
4. Both Statement I and Statement II are incorrect

Given below are two statements : In the light of the above statements, choose the correct answer from the options given below :

1. Statement I is true but Statement II is false
2. Statement I is false but Statement II is true
3. Both Statement I and Statement II are true
4. Both Statement I and Statement II are false

Unequivocal proof that DNA is the genetic material was first proposed by

1. Alfred Hershey and Martha Chase
2. Avery, MacLeod and McCarty
3. Wilkins and Franklin
4. Frederick Griffith

What is the role of RNA polymerase III in the process of transcription in Eukaryotes?

1. Transcription of tRNA, 5S rRNA and snRNA
2. Transcription of precursor of mRNA
3. Transcription of only snRNAs
4. Transcription of rRNAs (28S, 18S and 5.8S)

Expressed Sequence Tags (ESTs) refer to

1. All genes that are expressed as proteins.
2. All genes whether expressed or unexpressed.
3. Certain important expressed genes.
4. All genes that are expressed as RNA.

How many different proteins does the ribosome consist of?

1. 60
2. 40
3. 20
4. 80

Given below are two statements: In the light of the above statements, choose the correct answer from the options given below:

1. Both Statement I and Statement II are false.
2. Statement I is true but Statement II is false.
3. Statement I is false but Statement II is true.
4. Both Statement I and Statement II are true.

Given below are two statements: In the light of the above statements, choose the correct answer from the options given below:

1. Both Statement I and Statement II are false.
2. Statement I is correct but Statement II is false.
3. Statement I is incorrect but Statement II is true.
4. Both Statement I and Statement II are true.

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows 5′ AUCG AUCG AUCG AUCG AUCG AUCG AUCG 3′?

1. 3′ UAGC UAGC UAGC UAGC UAGC UAGC UAGC 5′
2. 5′ ATCG ATCG ATCG ATCG ATCG ATCG ATCG 3′
3. 3′ ATCG ATCG ATCG ATCG ATCG ATCG ATCG 5′
4. 5′ UAGC UAGC UAGC UAGC UAGC UAGC UAGC 3′

The process of translation of mRNA to proteins begins as soon as:

1. The small subunit of ribosome encounters mRNA
2. The larger subunit of ribosome encounters mRNA
3. Both the subunits join together to bind with mRNA
4. The tRNA is activated and the larger subunit of ribosome encounters mRNA

DNA polymorphism forms the basis of:

1. Genetic mapping
2. DNA fingerprinting
3. Both genetic mapping and DNA fingerprinting
4. Translation

Read the following statements and choose the set of correct statements: Choose the correct answer from the options given below :

1. (B), (D), (E) only
2. (A), (C), (D) only
3. (B), (E) only
4. (A), (C), (E) only